Mice
Four-week-old male and female C57Bl/6J mice were housed in cages of five individuals and maintained under a 12-h light/dark cycle. The male mice were housed with ad libitum access to standard chow diet (SAFEA03, Scientific Diets) and water, while the female mice were divided into three groups: a water-treated group, a group treated with 1% carboxymethyl cellulose (CMC), and a group treated with 1% polysorbate 80 (P80) in the drinking water. Cages for all groups were changed every other week. After 10 weeks of treatment, breeding pairs were formed by pairing two females with one male. Pregnant females were subsequently individually housed from gestation until weaning. On the day of birth, pups were either left with their biological mother or cross-fostered to dams with age-matching and size-matching litters. The resulting pups were categorized as follows:
Experiment 1—Figs. 1, 2, S2, and S4
Pups born to water-, CMC-, or P80-treated dams were either kept by their biological mother or cross-fostered with water-treated dams at birth. Male pups were weaned at 21 days-old under emulsifier-free conditions, with ad libitum access to water, and then subjected to a western diet (WD, D12492, Research Diets) for 13 weeks.
Experiment 2—Figs. 2, S5, S6
Pups born to water-, CMC-, or P80-treated dams were either kept by their biological mother or cross-fostered with water-, CMC-, or P80-treated dams at birth. Male pups were weaned at 21 days old under emulsifier-free conditions, with ad libitum access to standard chow diet and water. After 4 weeks, these mice were subjected to 1% dextran sodium sulfate (DSS) in the drinking water for 7 days.
Experiment 3—Fig. 3
Half of the male pups born to water-, CMC-, or P80-treated dams were used at day 18 to quantify goblet cells-associated antigen passage (GAP), while the other half were euthanized on the day of weaning and used for either RNA-seq or intestinal inflammation quantification.
Experiment 4—Fig. 4
Pups born to water-, CMC-, or P80-treated dams were injected daily intraperitoneally (IP) with 0.5 μg of Tyrphostin per gram of body weight from day 10 to day 2116. Female pups were used to quantify GAP at weaning. Male pups were weaned at 21 days old under emulsifier-free conditions, with ad libitum access to water, and then subjected to a WD for 13 weeks. Fasting glycemia was measured after 10 weeks of WD.
Experiment 5—Fig. S7
Dams’ P80 treatment was discontinued on the day of birth. Resulting pups, as well as control pups from water-treated dams, were used at day 18 to quantify colonic GAP, fat deposition, and intestinal inflammation.
Body weight was measured and feces were collected longitudinally throughout the experiments. Upon euthanasia, mice were anesthetized with isoflurane, blood samples collected, and mice were euthanized by cervical dislocation. Measurements of colon length, colon weight, spleen weight, and adipose weight were recorded, and tissue samples were collected for downstream analysis. Animal welfare and experimental protocols followed the ARRIVE guidelines (Animal Research: Reporting of in vivo Experiments). All procedures involving animals were approved by the French Ministère de la l’enseignement supérieur, de la recherche et de l’innovation, APAFIS#24788-2019102806256593 v8.
Milk collection
Following 6 h of pups isolation from their mother, dams are injected IP with 1.5 UI of Ocytocine-S, (Sigma, O3251) prior anesthesia with isoflurane for milk collection. Milk samples were snap frozen for downstream analysis.
Colonic GAP staining and quantification
Pups were subjected to intro-colonic injection with 0.25 mg of Ovalbumin Alexa Fluor 647 conjugated (Invitrogen 034784). After 1 h, mice were euthanized and colons were opened longitudinally and washed twice in PBS prior fixation in 4% paraformaldehyde. Following embedding in paraffin with a vertical orientation, five-μm sections were cut and dewaxed by bathing in xylene at 60 °C for 10 min, xylene at room temperature for 10 min, and 99.5% ethanol for 10 min. Sections were marked using a PAP pen (Sigma, St. Louis, MO, USA) and block solution (5% FBS in PBS) was added for 30 min at 4 °C. Mucin-2 primary antibody (rabbit H-300, [C3], C-term, Genetex, GTX100664) was diluted to 1:100 in block solution and applied overnight at 4 °C. After washing 3 × 10 min in PBS, block solution containing anti-rabbit Alexa 488 secondary antibody diluted to 1:300, PhalloidinTetramethylrhodamine B isothiocyanate (Sigma-Aldrich) at 1 mg ml−1 and Hoechst 33258 (Sigma-Aldrich) at 10 mg ml−1 was applied to the section for 2 h. After washing 3 × 10 min in PBS slides were mounted using Prolong anti-fade mounting media (Life Technologies) and kept in the dark at 4 °C. Observations and measurement of the distance between bacteria and epithelial cell monolayer were performed with a Spinning Disk IXplore using the Olympus cellSens imaging software 421 (V2.3) at a frame size of 2048 × 2048 with 16-bit depth. A 405 nm laser was used to excite the 422 Hoechst stain (epithelial DNA), 488 nm for Alexa Fluor 488 (mucus), 488 nm for Phalloidin (actin), 423 and 640 nm for Alexa Fluor 647 (ovalbumin). Samples were imaged with a ×10 objective, and GAP identified as ovalbumin-labeled goblet cells were quantified over 50 villus using QuPath 0.5.0 software.
Fasting blood glucose measurement
After 10 weeks of WD, mice were placed in a clean cage and fasted for 15 h. Blood glucose concentration was then determined using a Nova Max Plus Glucose Metre and expressed in mg/dL.
Steatosis and fibrosis scoring
Following euthanasia, livers were harvested and fixed in 4% paraformaldehyde, embedded in paraffin, five-μm sectioned, and stained with hematoxylin and eosin (steatosis) or Sirius red (fibrosis). Steatosis was evaluated blindly and as previously described56. Briefly, on 5 equal size section of each slide, a score between 0 and 3 was given to macrovesicular steatosis, microvesicular steatosis, hypertrophy, and number of inflammation foci56. Fibrosis was determined by measuring the percentage of Sirius-positive area on the whole section.
Staining of colonic tissue and histopathologic analysis
Following euthanasia, colons (proximal colon, 2 first cm from the cecum) were placed in Carnoy’s fixative solution (60% methanol, 30% chloroform, 10% glacial acetic acid). Tissues were then washed in methanol 2 × 30 min, ethanol 2 × 15 min, ethanol/xylene (1:1) 15 min, and xylene 2 × 15 min, followed by embedding in paraffin with a vertical orientation. Tissues were sectioned at 5-μm thickness and stained with hematoxylin & eosin (H&E) using standard protocols. H&E-stained slides were assigned four scores based on the degree of epithelial damage and inflammatory infiltrate in the mucosa, submucosa, and muscularis/serosa. Each of the four scores was multiplied by 1 if the change was focal, 2 if it was patchy, and 3 if it was diffuse, as previously described57. The four individual scores per colon were added, resulting in a total scoring range of 0–36 per mouse.
Colonic sections (4 μm) were also stained with Alcian Blue, preferentially staining mucopolysaccharides, and 17–23 crypts of 3 regions per colonic sections were randomly selected per animal to determine goblet-cell number per crypt.
Liver and colon mRNAs extraction and q-RT-PCR analysis
Distal colons were collected during euthanasia and placed in RNAlater. Total mRNAs were isolated from colonic tissues using TRIzol (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions and as previously described57. Quantitative RT-PCR was performed using the Qiagen kit QuantiFast® SYBR® Green RTPCR in a LigthCycler® 480 instrument (Roche Molecular Systems, Inc.) with mouse gene-specific oligonucleotides (Supplementary Table 1). Gene expressions are presented as relative values using the Ct approach with the 36B4 housekeeping gene.
Ex-vivo cell culture and cytokine quantification
Cells from mesenteric lymph nodes (mLN) were isolated as follow: mLN were collected in HBSS prior cell dissociation by pushing cells through a 100 μm filter with a syringe plug. Cells were then washed once in HBSS before resuspending 500,000 cells in RPMI for culture. After 24 h, cells are collected and mRNAs were extracted as described above.
Small intestine, colon, and mLN cell preparation, and flow cytometry analysis
mLN cells were isolated as previously described in the method section. For small intestinal and colonic lamina propria cells isolation, Peyer’s Patches were removed, and whole small intestine and colon were opened longitudinally, cut into pieces, and incubated for 30 min in 30 mM EDTA, washed extensively, and incubated for 15 min at least twice in 1 mg/mL collagenase D and 1 U/mL DNAse I in HBSS. These preparations were then pushed through a 100 μm filter to generate single-cell suspensions. Cells were separated by a 40/80% (w/v) Percoll (GE Healthcare) density gradient and washed prior to staining for flow cytometry analysis. Cells were then pre-incubated with Zombie UV™ Fixable Viability Kit for 30 min, Fc-Block for 15 min, and stained for 20 min with the following antibodies: anti-CD45 PERCP (530-F11; Biolegend), anti-B220 Pacific Blue (RA3-6B2; BD Biosciences), anti-CD3 BV711 (17A2; Biolegend). Cells isolated from ileum and mLN were additionally stained with anti-CD138 BB515 (281-2; BD Biosciences), anti-IgA BV786 (C10-1; BD Biosciences), anti-CD4 (GK1.5; BD Biosciences), anti-CD8 V500 (53-6.7; BD Biosciences), anti-CD127 BV605 (A7R34; Biolegend), anti-CD25 BV650 (PC61; BD Biosciences) and intracellular staining was performed following fixation and permeabilization with anti-Tbet PE-CF594 (O4-46; BD Biosciences), anti-Gata3 AF700 (TWAJ; eBioscience), anti-RorɣT PE (Q31-378; BD Biosciences), anti-FoxP3 APC (FJK16s; eBioscience). Cells isolated from colon were additionally stained with anti-MHCII APC-Cy7 (M5/114.15.2; Biolegend), anti-CD115 APC (AFS98; eBioscience), anti-Ly6G/C BV650 (RB6-8C5; Biolegend), anti-CD103 PE-CF594 (M290; BD Biosciences), anti-CD11c BB515 (NA18; BD Biosciences), anti-CX3CR1 AF700 (SA011F11; Biolegend), anti-CD206 PE (C068C2; Biolegend), anti-CD27 BV786 (LG3A10; BD Biosciences) and anti-CD11b BV421 (M1/70; BD Biosciences). Samples were acquired on a BD LSRFortessa™ Cell Analyzer, and data were analyzed using a non-supervised approach using the Omiq software.
Colonic mRNAs sequencing
Distal colon was collected during euthanasia and placed in RNAlater. Total mRNAs were isolated from colonic tissues using TRIzol (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions and as previously described57.
Library preparation and sequencing
cDNA library was prepared using the InvitrogenTM CollibriTM Stranded RNA library Prep Kit for IlluminaTM with CollibriTM H/M/R rRNA Depletion Kit according to the manufacturer’s instructions and starting with 500 ng of purified RNAs. Briefly, rRNA were first depleted, and enriched mRNAs subsequently used for fragmentation, adaptors ligation, and reverse transcription. After purification, libraries were PCR-enriched, further purified, and quantified and quality-assessed on an AgilentTM 2100 BioanalyzerTM instrument. A master library was generated from the purified products in equimolar ratios. The pooled product was quantified using Qubit and sequenced using an Illumina Next-Seq sequencer (paired-end reads, 2 × 750 bp).
Data analysis
Cutadapt online tool58 was used to remove adapter sequences as well as trim sequences from the first low-quality (<28) base. High-quality reads longer than 20 nucleotides were then aligned to the mm10 mus musculus reference genome using Bowtie259. Gene expression levels were next measured using Cufflinks60 and differentially expressed genes between conditions were identified using Cuffdiff 60. Fragments Per Kilobase of transcript per Million mapped reads (FPKM) unit was used and Log2 fold changes and p-values were computed for each comparison of interest. Gene level volcano plots were generated through R (R version 4.2.3) and differentially expressed genes enrichment analysis was performed using the edgeR R package61 (package version 3.40.2) to identify genes with Log2 fold changes ≥ log(2) or ≤ −log(2) and p-value ≤ 0.05. Differentially expressed genes pathways enrichment analysis was performed using the PANTHER classification sytem62 and significant pathways with FDR ≤ 0.05 and more than 6 DEG involved were represented as enrichment plot (enrichment_chart, R package v2.3.0).
Caecal metabolites quantification
Proton nuclear magnetic resonance (1H NMR)—based metabolomics was performed on 100 mg of frozen caecal content as previously described63. Data pretreatment and statistical analysis with principal component analysis was performed using full resolution spectra in MATLAB (R2021a; MathsWorks, Inc.).
Maternal milk metabolites qualification and detection of CMC and P80
Maternal milk metabolites were quantified using 1H NMR-based metabolomics as described in our previous study with minor modifications64. Approximately 200 μl of milk were mixed 1 mL of methanol:chloroform (2:1 v/v), vortexed for 30 s, and then 133 µL of nanopure distilled water and 333 µL of chloroform were sequentially added to the sample, vortexed for 30 s, and kept overnight at 4 °C. After centrifugation at 6000 × g at 4 °C for 20 min, the polar phase was collected in a 2 mL microcentrifuge tube and dried down using a SpeedVac vacuum concentrator. The dried extract was resuspended in 0.55 ml of 0.1 M PBS (50% D2O, 0.005% w/v TSP), and after centrifugation at 17000 × g at 4 °C for 10 min, the supernatant was transferred into 5 mm NMR tube for NMR analysis. The 1D 1H spectra of milk extracts were acquired at 298 K using a Bruker Avance NEO 600 MHz spectrometer equipped with a SampleJet sample changer (Bruker Biospin, Germany). The standard pulse sequence (noesygppr1d) was used for recording 1H NMR experiments with pre-saturation water suppression during relaxation and mixing time. All spectra were processed automatically with Chenomx NMR Suite 10 (Chenomx Inc., Edmonton, Alberta, Canada), and each spectrum was checked and adjusted manually for phase and baseline to satisfy quality requirements. Metabolites were identified and quantified using the built-in metabolite library and fitting algorithm in the Chenomx software, combined with the known concentrations internal standard (TSP, 0.29 mM).
Quantification of fecal IgA-coated bacteria
IgA-coated bacteria were quantified as previously described65. In brief, frozen fecal samples were thoroughly homogenized in PBS to a final concentration of 20 mg/mL. Fecal suspensions were filtered through a 40-μm sterile nylon mesh, then centrifuged at 50 × g, for 15 min at 4 °C. 200 μL of supernatant was then washed with 1 mL PBS and centrifuged at 8000 × g, for 5 min at 4 °C. Resulting bacterial pellets were resuspended in 100 μl blocking buffer (staining buffer containing 20% Normal Rat Serum) and incubated for 20 min on ice before being stained with 100 μl of staining buffer containing PE-conjugated Anti-Mouse IgA (mA-6E1; eBioscience) for 30 min on ice, in the dark. Following two washes with staining buffer, pellets were resuspended in 200 μL of FACS buffer (PBS, 1% Normal Rat Serum). Data acquisition was performed on a Beckman Coulter Gallios flow cytometer. For each sample, 100,000 events were recorded and data was analyzed using FlowJo software v.10.8.2.
Milk total IgA and anti-flagellin/LPS IgA quantification by ELISA
Milk samples were resuspended 1 in 10 in collection media consisting of 0.05 mg soybean trypsin inhibitor per ml of a 3:1 mixture of 1× PBS and 0.1 M EDTA, pH 7.4. Following centrifugation at 400 g for 10 min, the supernatant was centrifuged again at 21,000 × g for 15 min at 4 °C, and final supernatant was collected and stored with 20% glycerol and 2 mM phenylmethylsulfonyl fluoride. Quantification of total IgA, anti-flagellin, and anti-LPS IgA was performed by coating 96-well microtiter plates (Costar, Corning, New York) with goat anti-mouse IgA (Southern Biotech), or 100 ng/well of laboratory-made Salmonella Typhimurium-derived flagellin, or 2 μg/well lipopolysaccharides (from E. coli 0128: B12, Sigma) in 9.6 pH bicarbonate buffer overnight at 4 °C. Serum or fecal samples from mice were then applied either pure at a final dilution of 1 in 10,000 for total IgA ELISA or 1 in 50 for anti-flagellin/LPS IgA ELISA for 1 h at 37 °C. After incubation and washing, the wells were incubated with horseradish peroxidase-linked anti-mouse IgA (Southern Biotech, 1040–05). Quantification of immunoglobulin was then developed by the addition of 3,3′,5,5′-Tetramethylbenzidine and the optical density was calculated by the difference between readings at 450 nm and 540 nm.
Microbiota analysis by 16S rRNA gene sequencing
16S rRNA gene amplification and sequencing were done using the Illumina MiSeq technology following the protocol of Earth Microbiome Project with their modifications to the MOBIO PowerSoil DNA Isolation Kit procedure for extracting DNA (www.earthmicrobiomeorg/emp-standard-protocols). Bulk DNA were extracted from frozen extruded feces using a PowerSoil-htp kit from MoBio Laboratories (Carlsbad, California, USA) with mechanical disruption (bead-beating). The 16S rRNA genes, region V4, were PCR amplified from each sample using a composite forward primer and a reverse primer containing a unique 12-base barcode, designed using the Golay error-correcting scheme, which was used to tag PCR products from respective samples66. We used the forward primer 515 F 5′- AATGATACGGCGACCACCGAGATCTACACGCTXXXXXXXXXXXXTATGGTAATTGTGTGYCAGCMGCCGCGGTAA-3′: the italicized sequence is the 5′ Illumina adapter, the 12 × sequence is the golay barcode, the bold sequence is the primer pad, the italicized and bold sequence is the primer linker and the underlined sequence is the conserved bacterial primer 515 F. The reverse primer 806 R used was 5′-CAAGCAGAAGACGGCATACGAGATAGTCAGCCAGCC GGACTACNVGGGTWTCTAAT-3′: the italicized sequence is the 3′ reverse complement sequence of Illumina adapter, the bold sequence is the primer pad, the italicized and bold sequence is the primer linker and the underlined sequence is the conserved bacterial primer 806 R. PCR reactions consisted of Hot Master PCR mix (Quantabio, Beverly, MA, USA), 0.2 μM of each primer, 10–100 ng template, and reaction conditions were 3 min at 95 °C, followed by 30 cycles of 45 s at 95 °C, 60 s at 50 °C, and 90 s at 72 °C on a Biorad thermocycler. Products were then visualized by gel electrophoresis and quantified using Quant-iT PicoGreen dsDNA assay (Clariostar Fluorescence Spectrophotometer). A master DNA pool was generated in equimolar ratios, subsequently purified with Ampure magnetic purification beads (Agencourt, Brea, CA, USA) and sequenced using an Illumina MiSeq sequencer (paired-end reads, 2 × 250 bp) at the Genom’IC platform (INSERM U1016, Paris, France).
16S rRNA gene sequence analysis
16S rRNA sequences were analyzed using QIIME2—version 202267. Sequences were demultiplexed and quality filtered using the Dada2 method68 with QIIME2 default parameters in order to detect and correct Illumina amplicon sequence data, and a table of QIIME2 artifact was generated using the folowing dada2 command: qiime dada2 denoise-paired –i-demultiplexed-seqs demux.qza –p-trim-left-f 0 –p-trim-left-r 0 –p-trunc-len-f 180 –p-trunc-len-r 180 –o-representative-sequences rep-seqs-dada2.qza –o-table table-dada2.qza –o-denoising-stats stats-dada2.qza –p-n-threads 6. A tree was next generated, using the align-to-tree- mafft-fasttree command, for phylogenetic diversity analyses, and alpha and beta diversity analyses were computed using the core-metrics-phylogenetic command. Principal coordinate analysis (PCoA) plots were used to assess the variation between the experimental group (beta diversity). For taxonomy analysis, features were assigned to operational taxonomic units (OTUs) with a 99% threshold of pairwise identity to the Greengenes reference database (version Greengenes2 2022.10).
Identification of microbiota members significantly altered in their relative abundance
Microbiota members presenting significant changes in their abundance at the family taxonomic level between Water and CMC/P80 offspring were identified using MaAsLin2 (Microbiome Multivariable Associations with Linear Models, version 2, R version 4.1.2, Maaslin2 version 1.12.0 package)69. Microbiota members were reported as significantly altered in their relative abundance if corrected q-value < 0.05 (Fig. 1e).
Identification of bacteria targeted by maternal milk IgA
Milk samples were initially diluted at a ratio of 1:50 with a bacterial suspension derived from RagKO mice fecal material70, which was previously resuspended in phosphate-buffered saline (PBS) to achieve a final concentration of 100 mg/mL after homogenization and filtration. Following a one-hour incubation period at 37 °C, IgA-coated bacteria were identified by flow cytometry following IgA staining, and a population enriched with IgA-positive bacteria, comprising 100,000 events, was isolated using a S3e Cell Sorter Biorad. Subsequently, DNA extraction was carried out from the sorted sample containing IgA-coated bacteria, as well as from the mixture resulting from the incubation of milk in the fecal suspension from Rag mice fecal material. The QIAamp Fast DNA Stool Mini Kit (Qiagen) was next used for DNA extraction. For taxonomic profiling, 16S sequencing was conducted, enabling the identification of bacteria bound by IgA. Significantly enriched bacteria were determined by comparing the IgA-coated bacteria enriched sorted sample with the product obtained from the incubation of milk in the fecal suspension from Rag mice fecal material, utilizing the MaAsLin2 approach.
Bioactive flagellin and LPS fecal load quantification
Levels of fecal bioactive flagellin and LPS were quantified, as previously described37, using human embryonic kidney (HEK)-Blue-mTLR5 and HEK-Blue-mTLR4, respectively (Invivogen, San Diego, California). Fecal material were resuspended in PBS to a final concentration of 100 mg.mL−1 and homogenized for 15 min using a vortex. We then centrifuged the samples at 8000 × g for 15 min and serially diluted the resulting supernatant and applied to mammalian cells. Purified Escherichia coli flagellin and LPS (Sigma, St Louis, Missouri) were used for standard curve determination using HEK-Blue-mTLR5 and HEK-Blue-mTLR4, respectively. After 24 h of stimulation, we applied cell culture supernatant to QUANTI-Blue medium (Invivogen, San Diego, California) and measured alkaline phosphatase activity at 620 nm after 30 min.
AhR ligands quantification in milk samples
Levels of AhR ligands were measured in milk samples using HT-29-Lucia™ AhR reporter cells (Invivogen, San Diego, California). Briefly, milk samples diluted 1:5 in PBS were centrifuged at 8000 × g, and the supernatant was applied to HT-29-Lucia™ AhR reporter cells. Luminescence was immediately measured, and sample concentrations were calculated based on the luminescence measurements of HT-29-Lucia™ AhR reporter cells stimulated with a known amount of the AhR ligand FICZ.
Immunostaining of mucins and localization of bacteria by fluorescent in situ hybridization
Mucus immunostaining was paired with fluorescent in situ hybridization (FISH), as previously described27,71, in order to analyze bacteria localization at the surface of the intestinal mucosa. In brief, colonic tissues (proximal colon, second cm from the caecum) containing fecal material were placed in methanol-Carnoy’s fixative solution (60% methanol, 30% chloroform, 10% glacial acetic acid) for a minimum of 3 h at room temperature. Tissues were then washed in methanol 2 × 30 min, ethanol 2 × 15 min, ethanol/xylene (1:1) 15 min, and xylene 2 × 15 min, followed by embedding in paraffin with a vertical orientation. Five-μm sections were cut and dewaxed by preheating at 60 °C for 10 min, followed by bathing in xylene at 60 °C for 10 min, xylene at room temperature for 10 min and 99.5% ethanol for 10 min. The hybridization step was performed at 50 °C overnight with an EUB338 probe (59-GCTGCCTCCCGTAGGAGT-39, with a 59 Alexa 647 label) diluted to a final concentration of 10 mg.mL−1 in hybridization buffer (20 mM TrisHCl, pH 7.4, 0.9 M NaCl, 0.1% SDS, 20% formamide). After washing for 10 min in wash buffer (20 mM Tris-HCl, pH 7.4, 0.9 M NaCl) and 3 × 10 min in PBS, a PAP pen (Sigma, St. Louis, Missouri) was used to mark around the section and block solution (5% FBS in PBS) was added for 30 min at 4 °C. Mucin-2 primary antibody (rabbit H-300, [C3], C-term, Genetex, GTX100664) was diluted to 1:100 in block solution and applied overnight at 4 °C. After washing 3 × 10 min in PBS, block solution containing anti-rabbit Alexa 488 secondary antibody diluted to 1:300, PhalloidinTetramethylrhodamine B isothiocyanate (Sigma-Aldrich) at 1 mg.ml−1 and Hoechst 33258 (Sigma-Aldrich) at 10 mg.ml−1 was applied to the section for 2 h. After washing 3 × 10 min in PBS slides were mounted using Prolong anti-fade mounting media (Life Technologies) and kept in the dark at 4 °C. Observations and measurement of the distance between bacteria and epithelial cell monolayer were performed with a Spinning Disk IXplore using the Olympus cellSens imaging software 421 (V2.3) at a frame size of 2048 × 2048 with 16-bit depth. A 405 nm laser was used to excite the 422 Hoechst stain (epithelial DNA), 488 nm for Alexa Fluor 488 (mucus), 488 nm for Phalloidin (actin), 423 and 640 nm for Alexa Fluor 647 (bacteria). Samples were imaged with a 20× objective. For quantification, three power fields per mouse were used to measure the distance between the 15 closest bacteria and the epithelial lining (for a total of 45 measurements per mouse).
Maternal treatment prediction based on offspring microbiota composition
The association between offspring microbiota composition and maternal treatment was assessed trough the prediction of maternal treatment based on offspring’s microbiota composition data. Prediction of CMC treatment (outcome CMC or Water, Fig. S2a–d), P80 treatment (outcome P80 or Water, Fig. S2e–h) was performed by computing receiver operating characteristic (ROC) curves (R version 4.1.2, randomForest 4.7-1.1 package, ROCR package) using training data set and validation data set containing randomly affected 80% and 20% of mice, respectively. Data set contained relative abundance data for microbiota members identified at the species level at weeks 4, 8, 12, and 16 of age. ROC calculation was repeated 50 times with random sampling of the training and validation data and area under curve (AUC) measurement for each iteration. Mean AUC and standard deviation are presented for each graph.
Statistical analysis
Significance was determined using, when normality and homoscedasticity postulates were valid, one-way group analysis of variance (ANOVA) with Sidak’s multiple comparisons test, or t-test when only two groups were involved. Significance of data that did not respect normality and homoscedasticity postulates was tested using Kruskal–Wallis corrected for multiple comparisons with a Dunn’s test or Brown–Forsythe and Welch ANOVA corrected for multiple comparisons with a Dunnett test, respectively. Significance of longitudinally-measured data was assessed using two-way ANOVA corrected for multiple comparisons with a Sidak’s test. Clustering significance in PCoA plot was determined using a ANOSIM analysis of similarities test. Differences were noted as significant *p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001; **** p ≤ 0.0001; n.s. indicates non-significant.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
link

